superscript ii rnase h rt (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher superscript ii rnase h rt
Superscript Ii Rnase H Rt, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/superscript+ii+rt/Ribonuclease+A/pm42000956-215-33-37
Average 99 stars, based on 1 article reviews

superscript ii rnase h rt - by Bioz Stars, 2026-09

99/100 stars

Images

Reverse Transcription:

Article Title: Backsplicing of the HIV-1 transcript generates multiple circRNAs to promote viral replication
Article Snippet: Processing of the viral transcript leads to the production of a series of circRNAs that can sponge miR-6727-3p and miR-4722-3p, inhibit their functions, and increase viral replication possibly via the P2RY8 dependent activation of CREB, AP-1, and c-Myc. npj Viruses | (2025) 3:21 8 circRNA isolation and quantification TotalRNAwas extractedutilizing aTRIzol (ThermoFisherScientific) based protocol we have optimized for the extraction of viral RNA60 and DNase treated with Turbo DNase (Thermo-Fischer Scientific). .. RNA was reverse transcribed utilizing a random pd(N)6 primer and Superscript II RT (Thermo Fischer Scientific). .. RT-PCR assays for the amplification of the circRNAs were carried out utilizing the 3 GHotStart TaqDNAPolymerase (BioBasic).

Article Title: Joint analysis of the nPOD-Virus Group data: the association of enterovirus with type 1 diabetes is supported by multiple markers of infection in pancreas tissue.
Article Snippet: Total pancreatic nucleic acids were extracted using the MagMax Viral RNA Isolation Kit (catalogue no. AM1939, Thermo Fisher, Waltham, MA, USA), without DNAse to prevent DNA removal. .. Extracted viral RNA was reverse transcribed using SuperScript II RT (catalogue no. 18064014, Thermo Fisher) and random hexamers. .. After short molecule and random hexamer removal with ChargeSwitch (catalogue no. CS12000, Thermo Fisher), molecules were amplified and tagged with a 12-basepair barcode tag containing a V8A2 semi-random primer (BC12-V8A2 construct using AccuPrime Taq polymerase and cleaned with a ChargeSwitch kit).

Synthesized:

Article Title: Mosaic H3K9me3 at BREACHes predicts synaptic gene expression associated with fragile X syndrome cognitive severity
Article Snippet: Then, we took 100 ng of RNA and prepared an RNA-seq library using the TruSeq Stranded Total RNA Library Prep Gold kit (Illumina, 20020598) per the manufacturer’s protocol. .. Briefly, we removed rRNA, synthesized cDNA with 0.8 U of SuperScript II RT (Thermo Fisher, 4376600) per sample, and performed A-tailing end repair. .. We then ligated indices from the TruSeq RNA Single Indexes Set A (Illumina, 20020492) and used Ampure XP beads (Beckman Coulter, A63881) to size select for DNA 300 bp long.

Protease Inhibitor:

Article Title: The establishment of nuclear organization in mouse embryos is orchestrated by multiple epigenetic pathways.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-H3K9me3 Abcam Cat#ab8898; RRID:AB_306848 Rabbit anti-H3K9me3 Millipore Cat#17-625; RRID:AB_916348 Mouse anti-H3K9me3 Active Motif Cat#39286; RRID:AB_2935892 Rabbit anti-H3K4me3 EpiCypher Cat#13-0041; RRID:AB_3076423 Rabbit anti-H3K4me3 Abcam Cat#ab8580; RRID:AB_306649 Rabbit anti-H3K4me3 Diagenode Cat#C15410003; RRID:AB_2924768 Rabbit anti-H3K27me3 Millipore Cat#07-449; RRID:AB_310624 Rabbit anti-H3K27me2 Abcam Cat#ab24684; RRID:AB_448222 Rabbit anti-H4K20me3 Millipore Cat#07-463; RRID:AB_310636 Mouse anti-H3K9me2 Abcam Cat#ab1220; RRID:AB_449854 Rabbit anti-H3K9me2 Active Motif Cat#39239; RRID:AB_2793199 Rabbit anti-H3K9ac Abcam Cat#ab4441; RRID:AB_2118292 Goat anti-LaminB1 Santa Cruz Cat#sc-6216; RRID:AB_648156 Rat anti-HA Roche Cat#11867423001; RRID:AB_390918 Guinea pig anti-Rabbit IgG secondary antibody AntibodiesOnline Cat#ABIN101961; RRID:AB_10775589 Goat anti-Rabbit IgG secondary antibody, Alexa 647 Invitrogen Cat#A-21244; RRID:AB_2535812 Goat anti-Mouse IgG secondary antibody, Alexa 555 Invitrogen Cat#A-21422; RRID:AB_2535844 Donkey anti-Goat IgG secondary antibody, Alexa 488 Invitrogen Cat#A-11055; RRID:AB_2534102 Goat anti-Rat IgG secondary antibody, Alexa 594 Invitrogen Cat#A-11007; RRID:AB_10561522 Biological samples Mouse preimplantation embryos Torres-Padilla Lab N/A Chemicals, peptides, and recombinant proteins Pregnant mare serum gonadotropin (PMSG) Ceva Pregmagon Human chorionic gonadotrophin (hCG) MSD Animal Health Ovogest Hyaluronidase Sigma Aldrich Cat#H3506 KSOM Torres-Padilla Lab N/A Paraffin oil Sigma Aldrich Cat#18512 Mineral oil Sigma Aldrich Cat#8410 3-Indoleacetic acid (Auxin) Sigma Aldrich Cat#I2886 Dimethyl sulfoxide (DMSO) Invitrogen Cat#D12345 GSK343 Selleckchem Cat#S7164 Pronase Roche Cat#10165921001 M2 Medium Sigma Aldrich Cat#M7167 Trypsin-EDTA (0.25%) Thermo Fisher Cat#25200056 10x PBS buffer, pH 7.4 Thermo Fisher Cat#AM9624 10x lysis buffer Clontech Cat#635013 dNTP mix Thermo Fisher Cat#R0192 RNase inhibitor Takara Cat#2313A (Continued on next page) ll OPEN ACCESS Cell 188, 1–20.e1–e9, June 26, 2025 e1 Please cite this article in press as: Pal et al., The establishment of nuclear organization in mouse embryos is orchestrated by multiple epigenetic pathways, Cell (2025), https://doi.org/10.1016/j.cell.2025.03.044 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER Superscript II RT Thermo Fisher Cat18064014 Betaine Sigma Aldrich Cat#B0300-1VL PEG-8000 Sigma Aldrich Cat#P1458 HiFi ReadyMix KAPA Cat#KM2605 1,4-Dithiothreitol (DTT) Sigma Aldrich Cat#D9779 MgCl2 Sigma Aldrich Cat#M1028 Spermidine Sigma Aldrich Cat#S2626 Protease inhibitor cocktail tablets Roche Cat#11873580001 NaCl (5M) Invitrogen Cat#AM9760G Triton-X 100 solution (10%) Sigma Aldrich Cat#93443 0.5 M EDTA, pH 8.0 Invitrogen Cat#15575-038 EGTA Sigma Aldrich Cat#3889 pAG-MNase EpiCypher Cat#15-1016 CaCl2 Sigma Aldrich Cat#C7902 Glycogen Thermo Fisher Cat#R0551 RNaseA Thermo Fisher Cat#EN0531 pA-Tn5 adaptor complex Diagenode Cat#C01070001 SDS solution (10%) Promega Cat#6551 NEBNext high-fidelity PCR master mix NEB Cat#M0541 Paraformaldehyde Sigma Aldrich Cat#P6148 Formaldehyde, methanol-free (16%) Thermo Fisher Cat#11586711 Bovine serum albumin (BSA) Sigma Aldrich Cat#A3311 Tween 20 Sigma Aldrich Cat#P1379 Vectashield antifade mounting medium with DAPI Vector Laboratories Cat#H-2000 dATP Thermo Fisher Cat#R0141 dCTP Thermo Fisher Cat#R0151 dGTP Thermo Fisher Cat#R0161 Aminoallyl-dUTP-ATTO-550 Jena Bioscience Cat#NU-803-550 Aminoallyl-dUTP-XX-ATTO-594 Jena Bioscience Cat#NU-803-XX-594 Aminoallyl-dUTP-ATTO-647N Jena Bioscience Cat# NU-803-647N Polyvinylpyrrolidone (PVP) Sigma Aldrich Cat#PVP40 Hydrochloric acid solution Sigma Aldrich Cat#H9892 Dextran sulphate sodium salt Sigma Aldrich Cat#D8906 Formamide Sigma Aldrich Cat#F9037 20x SSC buffer Sigma Aldrich Cat#S6639 Mouse Cot-1 DNA Invitrogen Cat#18440016 Klenow fragment (3’ to 5’ exo-) NEB Cat#M0212 T4 DNA ligase NEB Cat#M0202 2x MyTaq red mix Bioline Cat#BIO-25043 DpnI NEB Cat#R0176 NP-40 (10%) Biovision Cat#2111-100 Proteinase K Invitrogen Cat#2546 Critical commercial assays mMESSAGE mMACHINE T3 Transcription Kit Invitrogen Cat#AM1348 mMESSAGE mMACHINE T7 ULTRA Transcription Kit Invitrogen Cat#AM1345 (Continued on next page) ll OPEN ACCESS e2 Cell 188, 1–20.e1–e9, June 26, 2025 Please cite this article in press as: Pal et al., The establishment of nuclear organization in mouse embryos is orchestrated by multiple epigenetic pathways, Cell (2025), https://doi.org/10.1016/j.cell.2025.03.044 Resource .. REAGENT or RESOURCE SOURCE IDENTIFIER End-It DNA end-repair kit Epicentre Cat#ER81050 QIAquick PCR purification kit Qiagen Cat#28104 AMPure RNA magnetic beads Beckman Coulter Cat#A63987 AMPure XP DNA magnetic beads Beckman Coulter Cat#A63881 Nextera XT Illumina Cat#15032354 NucleoBond BAC 100 kit Macherey-Nagel Cat#740579 Nick translation mix Roche Cat#10976776001 Deposited data Single-cell RNA-seq data of mouse oocytes and preimplantation embryos Ramsköld et al.49; Deng et al.50 GEO: GSE38495, GSE45719 ATAC-seq Wu et al.51 GEO: GSE66581 H3K4me3 ChIP data Zhang et al.52 GEO: GSE71434 H3K36me3 ChIP data Xu et al.53 GEO: GSE112834 H3K27ac ChIP data Dahl et al.54 GEO: GSE72784 H3K9me3 ChIP data Wang et al.33 GEO: GSE98149 H3K27me3 ChIP data Zheng et al.37 GEO: GSE76687 Pol2 Stacc-seq data Liu et al.55 GEO: GSE135457 DNaseI-seq data Lu et al.56 GEO: GSE76642 Hi-C data Du et al.57 GEO: GSE82185 Single-embryo RNA-seq (SMART-seq+50) Oomen et al.58 GEO: GSE225056 Embryo LaminB1 DamID data and Allelic LAD coordinates Borsos et al.24 GEO: GSE112551 a-amanitin treatment LaminB1 DamID data Pal et al.25 GEO: GSE241483 LaminB1 DamID This paper GEO: GSE244496 H3K9me3 CUT&RUN This paper GEO: GSE278718 H3K4me3 CUT&Tag This paper GEO: GSE278719 Single-embryo RNA-seq (SMART-seq+50) This paper GEO: GSE278720 Experimental models: Organisms/strains Mouse: F1 (C57BL/6J 3 CBA/H) females Janvier Labs MGI:5650652 Mouse: DBA/2J males Janvier Labs MGI:2684695 Oligonucleotides DamID Adapter_top: 5’-CTAATACGACT CACTATAGGGCAGCGTGGTCG CGGCCGAGGA-3’ Sigma Aldrich N/A DamID Adapter_bottom: 5’-TCCTCGGCCGCG-3’ Sigma Aldrich N/A Barcoded DamID PCR primers: 5’-NNNNNNBAR CODGTGGTCGCGGCCGAGGATC-3’ Sigma Aldrich N/A ERCC RNA spike in mix Invitrogen Cat#4456740 oligo-dT30V: 5’-AAGCAGTGGTATCA ACGCAGAGTACT30V-3’ Sigma Aldrich N/A TSO:5’-AAGCAGTGGTATCAACG CAGAGTACATrGrG+G-3’ TIB MolBiol N/A ISPCR oligo: 50-AAGCAGTGGTA TCAACGCAGAGT-30 Biomers.net N/A Illumina sequencing adaptor mix and primers IDT or Sigma Aldrich N/A Recombinant DNA pRN3P-AID-Dam-LaminB1 Borsos et al.24 N/A pRN3P-TIR1-3XMyc Borsos et al.24 Addgene #119766 pRN3P-EGFP-m6ATracer Borsos et al.24 Addgene #139403 (Continued on next page) ll OPEN ACCESS Cell 188, 1–20.e1–e9, June 26, 2025 e3 Please cite this article in press as: Pal et al., The establishment of nuclear organization in mouse embryos is orchestrated by multiple epigenetic pathways, Cell (2025), https://doi.org/10.1016/j.cell.2025.03.044 Resource

Polymerase Chain Reaction:

Real-time Polymerase Chain Reaction:

Article Title: Genetic background and microbiome drive susceptibility to epicutaneous sensitization and food allergy in adjuvant-free mouse model
Article Snippet: Total RNA was isolated from jejunum using the NucleoSpin RNA kit (Macherey-Nagel, Germany) according to the manufacturer ́s instruction. .. Random primers and SuperScript II RT (Thermo Fisher Scientific, USA) were used to reverse-transcribe 1 μg of extracted RNA. qPCR reaction was performed using Luminaris HiGreen Fluorescein qPCR Master Mix (Thermo Fisher Scientific, USA) with Real-Time PCR Thermal Cycler qTOWER3G. ..

cDNA Synthesis:

Article Title: Hyaluronic acid: Function and location in the urothelial barrier for bladder pain syndrome/interstitial cystitis, an in vitro study.
Article Snippet: RNA was isolated with TRIzol (Life Technologies ThermoFisher Scientific, United States) and quantity assessed by nanodrop (ND-2000 Spectrophotometer (ThermoFisher Scientific, United Kingdom). .. RNA was stored at −20 °C. cDNA synthesis was performed using hexamer primers and SuperScript II RT (Thermo Fisher Scientific, Waltham, USA). ..

Introduce:

Article Title: RNA and DNA analysis using engineered surfaces
Article Snippet: This reaction may be catalyzed by M-MLV reverse transcriptase, AMV reverse transcriptase, or a group II intron-encoded reverse transcriptase, e.g. InduroTM Reverse Transcriptase (NEB). .. Some commercial M-MLV mutants, such as Superscript II RT (Thermo Fisher), Superscript IV RT (Thermo Fisher) and Maxima H Minus RT (Thermo Fisher) are capable of catalyzing template switching reactions, which may be used to introduce a second adapter after barcode transfer (see, e.g., FIG. 5 and FIG. 6). ..

Review